Prev. |  KEGG KO K02326 > 

RIKEN DNA Bank Human Resource - POLE3

Gene ID NCBI Gene 54107 |  KEGG hsa:54107
Gene Symbol POLE3
Protein Name DNA polymerase epsilon 3, accessory subunit
Synonyms CHARAC17|CHRAC17|CHRAC2|YBL1|p17
Featured content DNA repair (human)
Ortholog resource in our bank

  POLE3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080921 IRAL002F01 pOTB7 BC004170 NM_017443 Full/var
HGY083731 IRAL009F11 pOTB7 BC003166 NM_017443 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE000470 W01A001C22 pENTR-TOPO IRAL002F01 BC003166 NM_017443  
HGE000472 W01A001C24 pENTR-TOPO IRAL002F01 BC003166 NM_017443  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR191678 ARi79D06 pGCAP10 NM_017443.4  
GAGCGGCGGCAATGGCGGAGAGGCCCGAGGACCTAAACCTGCCCAATGCCGTGATCACCA
HKR405518 RBdS013N06 pGCAP10 NM_017443.4  
GGTCAGACCGTAGCGACGCGGGAAGTCCGGACGCAGTAGCTCCCTGAAGCGGAGGCGAAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl