Prev. | Human A to Z list > P > 

RIKEN DNA Bank Human Resource - POLE3

Gene ID (NCBI) 54107
Gene Symbol POLE3
Protein Name polymerase (DNA directed), epsilon 3, accessory subunit
Synonyms CHARAC17|CHRAC17|YBL1|p17
Databases KEGG link 01 |  NCBI Gene link 01
Featured content DNA repair (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K02326)


Genome Network Project (GNP) Human cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY080921 IRAL002F01 pOTB7 BC004170 NM_017443 Full/var
HGY083731 IRAL009F11 pOTB7 BC003166 NM_017443 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE000470 W01A001C22 pENTR-TOPO IRAL002F01 BC003166 NM_017443  
HGE000472 W01A001C24 pENTR-TOPO IRAL002F01 BC003166 NM_017443  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR191678 ARi79D06 pGCAP10 NM_017443.4  
GAGCGGCGGCAATGGCGGAGAGGCCCGAGGACCTAAACCTGCCCAATGCCGTGATCACCA
HKR405518 RBdS013N06 pGCAP10 NM_017443.4  
GGTCAGACCGTAGCGACGCGGGAAGTCCGGACGCAGTAGCTCCCTGAAGCGGAGGCGAAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.06.01

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl