Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03518

HP ID(1) HP03518
Gene ID(2) 51368
Gene Symbol finder TEX264
Protein Name testis expressed sequence 264
RefSeq NM_015926.3
Length of RefSeq (bp) 1601
Chromosome 3p21.31
Reference DDBJ accession
UniGene Hs.517864

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe09E09 pKA1U5 GGCCTGCGCGGATCGGCGTCCGCAGCGGGCGGCTGCTGAGCTGCCTTGAGGTGCAGTGTT
ARiS118I04 pGCAP10 GGTAACCGAACCCTGAGCCGCCTGCGCGGATCGGCGTCCGCAGCGGGCGGCTGCTGAGGG
RBd52C05 pGCAP10 GGCGCGGATCGGCGTCCGCAGCGGGCGGCTGCTGAGCTGCCTTGAGGTGCAGTGTTGGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl