Prev. | 

RIKEN DNA Bank Human Resource - TEX264

Gene ID NCBI Gene 51368 |  KEGG hsa:51368
Gene Symbol TEX264
Protein Name testis expressed 264, ER-phagy receptor
Synonyms ZSIG11
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082064 IRAL005C16 pOTB7 BC008742 NM_015926

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR043705 ARe09E09 pKA1U5 NM_015926.3  
GGCCTGCGCGGATCGGCGTCCGCAGCGGGCGGCTGCTGAGCTGCCTTGAGGTGCAGTGTT
HKR247396 ARiS118I04 pGCAP10 NM_015926.3  
GGTAACCGAACCCTGAGCCGCCTGCGCGGATCGGCGTCCGCAGCGGGCGGCTGCTGAGGG
HKR380853 RBd52C05 pGCAP10 NM_015926.3  
GGCGCGGATCGGCGTCCGCAGCGGGCGGCTGCTGAGCTGCCTTGAGGTGCAGTGTTGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl