Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03492

HP ID(1) HP03492
Gene ID(2) 10950
Gene Symbol finder BTG3
Protein Name BTG family, member 3?
RefSeq NM_006806.4
Length of RefSeq (bp) 1464
Chromosome 21q21.1-q21.2
Reference DDBJ accession
UniGene Hs.473420

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi72D07 pGCAP10 GACTCGTGTGCGCGCTCGTCCGCCCGCCAGTCCTCTCAACGCGCGCTTGGCCGCCCGACG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl