Prev. |  KEGG KO K14443 > 

RIKEN DNA Bank Human Resource - BTG3

Gene ID NCBI Gene 10950 |  KEGG hsa:10950
Gene Symbol BTG3
Protein Name BTG anti-proliferation factor 3
Synonyms ANA|ANA/BTG3|APRO4|TOB5|TOB55|TOFA
Ortholog resources KEGG ortholog (KEGG orthology K14443) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008475 IRAK021D03 pCMV-SPORT6 BC011957 NM_006806 Full/var
HGX025074 IRAK062L10 pCMV-SPORT6 BC028229 NM_006806 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR188879 ARi72D07 pGCAP10 NM_006806.4  
GACTCGTGTGCGCGCTCGTCCGCCCGCCAGTCCTCTCAACGCGCGCTTGGCCGCCCGACG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl