Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03388

HP ID(1) HP03388
Gene ID(2) 5093
Gene Symbol finder PCBP1
Protein Name poly(rC) binding protein 1
RefSeq NM_006196.2
Length of RefSeq (bp) 1634
Chromosome 2p13-p12
Reference DDBJ accession
UniGene Hs.2853

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe03G02 pKA1U5 GAGACCGCCGAGGCTGCCGCCGGAGTCGCCACCCCCNTGNCCGTCGTNCANNNGNACGNN
ARe10B09 pKA1U5 GGCCGANGGCTGCCGCCGGAGTCGCCACCGCCGCGCCCTCGCCCACTCGCTCNGCCCGTC
ARi34E03 pGCAP10 GAGACCGCCGAGGCTGCCGCCGGAGTCGCCACCGCCGCGCCCTCGCCCGNCCCNTTCNCN
ARiS049F01 pGCAP10 GAGACCGCCGAGGCTGCCGCCGGANTCGCCACCGCCNCGCCCTCGCCNAANANNACNANT
RBb67C08 pGCAP1 GGCCGAGGCTGCCGCCGGAGTCGCCACCGCCGCGCCCTCGCCCACCCGCGCGCCCGCCGC
RBd13B09 pGCAP10 GAGACCGCCGAGGCTGCCGCCGGAGTCGCCACCGCCGCGCCCTCGACATGNNGCNNTGAT
RBd54H06 pGCAP10 GGCCGAGGCTGCCGCCGGAGTCGCCACCGCCGCGCCCTCGCCNANNNNCNNGCCCGCCGN
RBd70A09 pGCAP10 GGCCGAGGCTGCCGCCGGAGTCGCCACCGCCGCGCCCTCGCCCANCCGTNNTAAAGGGAC
RBd72E10 pGCAP10 GGCTTCCCGCCCCGCCCAGACCGCCGAGGCTGCCGCCGGAGTCGCCACCGCCGCGCCCTC
RBd88D12 pGCAP10 GGCCGAGGCTGCCGCCGGAGTCGCCACCGCCGCGCCCTCGCCCACCCGCCCGCGTATCGT
RBdS014N06 pGCAP10 GGCTGCCGCCGGAGTCNCCACCGCCGCGCCCTCGTNNTNNTAACCATCATTNGNTTNATC
RBdS015P07 pGCAP10 GGCTGCCGCCGGAGTCGCCACCGCCGCGCCCTCGNCAATNNGAGANNTNNTANATNNNGN
RBdS081K02 pGCAP10 GAGACCGCCGAGGCTGCCGCCGGAGTCGCCACCGCCGCGCCCTCGNTTNNTGGTTTTTTT
RBdS132N11 pGCAP10 GACCNCCGNNGCTGCCGCCGGAGTCGCCACCGCCGCGCCCTCGNNNNNNNNNNNNTAAAN
RBdS187O11 pGCAP10 TGGCCGAGGCTGCCGCCGGAGTCGCCACCGCCGCGCCCTCGNNACCATGNANTACNNNNN

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl