Prev. |  KEGG KO K12889 > 

RIKEN DNA Bank Human Resource - PCBP1

Gene ID NCBI Gene 5093 |  KEGG hsa:5093
Gene Symbol PCBP1
Protein Name poly(rC) binding protein 1
Synonyms HEL-S-85|HNRPE1|HNRPX|hnRNP-E1|hnRNP-X
Ortholog resources KEGG ortholog (KEGG orthology K12889) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX033182 IRAK082P22 pCMV-SPORT6 BC039742 NM_006196 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041346 ARe03G02 pKA1U5 NM_006196.2  
GAGACCGCCGAGGCTGCCGCCGGAGTCGCCACCCCCNTGNCCGTCGTNCANNNGNACGNN
HKR044033 ARe10B09 pKA1U5 NM_006196.2  
GGCCGANGGCTGCCGCCGGAGTCGCCACCGCCGCGCCCTCGCCCACTCGCTCNGCCCGTC
HKR173699 ARi34E03 pGCAP10 NM_006196.2  
GAGACCGCCGAGGCTGCCGCCGGAGTCGCCACCGCCGCGCCCTCGCCCGNCCCNTTCNCN
HKR219721 ARiS049F01 pGCAP10 NM_006196.2  
GAGACCGCCGAGGCTGCCGCCGGANTCGCCACCGCCNCGCCCTCGCCNAANANNACNANT
HKR346856 RBb67C08 pGCAP1 NM_006196.2  
GGCCGAGGCTGCCGCCGGAGTCGCCACCGCCGCGCCCTCGCCCACCCGCGCGCCCGCCGC
HKR365233 RBd13B09 pGCAP10 NM_006196.2  
GAGACCGCCGAGGCTGCCGCCGGAGTCGCCACCGCCGCGCCCTCGACATGNNGCNNTGAT
HKR381774 RBd54H06 pGCAP10 NM_006196.2  
GGCCGAGGCTGCCGCCGGAGTCGCCACCGCCGCGCCCTCGCCNANNNNCNNGCCCGCCGN
HKR388009 RBd70A09 pGCAP10 NM_006196.2  
GGCCGAGGCTGCCGCCGGAGTCGCCACCGCCGCGCCCTCGCCCANCCGTNNTAAAGGGAC
HKR388906 RBd72E10 pGCAP10 NM_006196.2  
GGCTTCCCGCCCCGCCCAGACCGCCGAGGCTGCCGCCGGAGTCGCCACCGCCGCGCCCTC
HKR395284 RBd88D12 pGCAP10 NM_006196.2  
GGCCGAGGCTGCCGCCGGAGTCGCCACCGCCGCGCCCTCGCCCACCCGCCCGCGTATCGT
HKR405918 RBdS014N06 pGCAP10 NM_006196.2  
GGCTGCCGCCGGAGTCNCCACCGCCGCGCCCTCGTNNTNNTAACCATCATTNGNTTNATC
HKR406367 RBdS015P07 pGCAP10 NM_006196.2  
GGCTGCCGCCGGAGTCGCCACCGCCGCGCCCTCGNCAATNNGAGANNTNNTANATNNNGN
HKR432642 RBdS081K02 pGCAP10 NM_006196.2  
GAGACCGCCGAGGCTGCCGCCGGAGTCGCCACCGCCGCGCCCTCGNTTNNTGGTTTTTTT
HKR453123 RBdS132N11 pGCAP10 NM_006196.2  
GACCNCCGNNGCTGCCGCCGGAGTCGCCACCGCCGCGCCCTCGNNNNNNNNNNNNTAAAN
HKR475147 RBdS187O11 pGCAP10 NM_006196.2  
TGGCCGAGGCTGCCGCCGGAGTCGCCACCGCCGCGCCCTCGNNACCATGNANTACNNNNN

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl