Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03382

HP ID(1) HP03382
Gene ID(2) 6901
Gene Symbol finder TAZ
Protein Name tafazzin
RefSeq NM_000116.3
Length of RefSeq (bp) 1919
Chromosome Xq28
Reference DDBJ accession
UniGene Hs.409911

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd90G07 pGCAP10 GCCCGTTCCGCAGCGCGCCCACGGCCTGTGACCCCGGCGACCGCTCCCCAGTGACGAGAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl