DNA Bank Top |  KEGG KO K13511 > 

RIKEN DNA Bank Human Resource - TAFAZZIN

Gene ID NCBI Gene 6901 |  KEGG hsa:6901
Gene Symbol TAFAZZIN
Protein Name tafazzin, phospholipid-lysophospholipid transacylase
Synonyms BTHS|CMD3A|EFE|EFE2|G4.5|LVNCX|TAZ|Taz1

Link

Ortholog resource in our bank

  TAFAZZIN

External database

human TAFAZZIN

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB14400 pCIneoFH-TAZ Expression vector of FLAG- and His6-tagged human TAZ.    
RDB14399 pCIneoLuc-TAZ Expression vector of luciferase-fused human TAZ.    
RDB13967 pLL3.7 K122 FH-TAZ-ires-GFP-TEAD-responsive-H2B mCherry A system that monitors directly the TAZ-dependent transcription.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005166 IRAK012P06 pCMV-SPORT6 BC011515 NM_181314

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE014113 W01A035E17 pENTR-TOPO IRAK012P06 BC011515 NM_181314  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR396151 RBd90G07 pGCAP10 NM_000116.3  
GCCCGTTCCGCAGCGCGCCCACGGCCTGTGACCCCGGCGACCGCTCCCCAGTGACGAGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.10.03

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl