Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03373

HP ID(1) HP03373
Gene ID(2) 55858
Gene Symbol finder TMEM165
Protein Name transmembrane protein 165
RefSeq NM_018475.2
Length of RefSeq (bp) 1715
Chromosome 4q12
Reference DDBJ accession
UniGene Hs.479766

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe07G02 pKA1U5 GGCTGACTCCAGTTTAGCCGCCGCCGGAGAGGACGGGCGCCGAGCCGGGGCTGCGGACTT
ARe60D08 pKA1U5 ATCCTGGGCCGCGCCGAGGCAGCTGGCTGACTCCAGTTTAGCCGCCGCCGGAGAGGACGG
ARe60F11 pKA1U5 GGCGCGCGCCTAACGGCTTAGCTGGGCTCACTCGGTCTGAGAGGTCGGAGTCTGCGAGTG
ARi28H11 pGCAP10 TGGAGTCGGGGCTGGGCCGCGCCGAGGCAGCTGGCTGACTCCAGTTTAGCCGCCGCCGGA
ARi31G07 pGCAP10 GGCCGCGCCGAGGCAGCTGGCTGACTCCAGTTTAGCCGCCGCCGGAGAGGACGGGCGCCG
RBd98E08 pGCAP10 GGACTCCAGTTTAGCCGCCGCCGGAGAGGACGGGCGCCGANCCGGGGCTGCGGANTTCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl