Prev. |  KEGG KO K23541 > 

RIKEN DNA Bank Human Resource - TMEM165

Gene ID NCBI Gene 55858 |  KEGG hsa:55858
Gene Symbol TMEM165
Protein Name transmembrane protein 165
Synonyms CDG2K|FT27|GDT1|TMPT27|TPARL
Ortholog resource in our bank

  TMEM165

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085559 IRAL013O23 pOTB7 BC003545 NM_018475 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR042946 ARe07G02 pKA1U5 NM_018475.2  
GGCTGACTCCAGTTTAGCCGCCGCCGGAGAGGACGGGCGCCGAGCCGGGGCTGCGGACTT
HKR064080 ARe60D08 pKA1U5 NM_018475.2  
ATCCTGGGCCGCGCCGAGGCAGCTGGCTGACTCCAGTTTAGCCGCCGCCGGAGAGGACGG
HKR064131 ARe60F11 pKA1U5 NM_018475.2  
GGCGCGCGCCTAACGGCTTAGCTGGGCTCACTCGGTCTGAGAGGTCGGAGTCTGCGAGTG
HKR171379 ARi28H11 pGCAP10 NM_018475.2  
TGGAGTCGGGGCTGGGCCGCGCCGAGGCAGCTGGCTGACTCCAGTTTAGCCGCCGCCGGA
HKR172551 ARi31G07 pGCAP10 NM_018475.2  
GGCCGCGCCGAGGCAGCTGGCTGACTCCAGTTTAGCCGCCGCCGGAGAGGACGGGCGCCG
HKR399304 RBd98E08 pGCAP10 NM_018475.2  
GGACTCCAGTTTAGCCGCCGCCGGAGAGGACGGGCGCCGANCCGGGGCTGCGGANTTCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl