Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03360

HP ID(1) HP03360
Gene ID(2) 10935
Gene Symbol finder PRDX3
Protein Name peroxiredoxin 3
RefSeq NM_006793.2
Length of RefSeq (bp) 1591
Chromosome 10q25-q26
Reference DDBJ accession
UniGene Hs.523302

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe27D11 pKA1U5 GGAGTGCACTGAAGATGGCGGCTGCTGTAGGACGGTTGCTCCGAGCGTCGGTTGCCCGAC
ARe78G01 pKA1U5 GACTGAAGATGGCGGCTGCTGTAGGACGGTTGCTCCGAGCGTCGGTTGCCCGACATGTGA
ARe82H12 pKA1U5 GGTGGCGCCCGAGTGCACTGAAGATGGCGGCTGCTGTAGGACGGTTGCTCCGAGCGTCGG
ARf06F06 pKA1U5 GGTGGCGCCCGAGNTGCACTGAAGATGGCGGCTGCTGTTAGGACGGTTGCTCCGAGCGTC
ARi11F04 pGCAP10 GGCCCGAGTGCACTGAAGATGGCGGCTGCTGTAGGACGGTTGCTCCGAGCGTCGGTTGCC
ARi14H03 pGCAP10 GGAGTGCACTGAAGATGGCGGCTGCTGTAGGACGGTTGCTCCGAGCGTCGGTTGCCCGAC
ARi52B01 pGCAP10 GTCAGACTTAACTAAGCAGATTTCCCGAGACTACGGTGTGCTGTTAGAAGGTTCTGGTCT
ARi70F07 pGCAP10 GGTGGCGCCCGAGTGCACTGAAGATGGCGGCTGCTGTAGGACGGTTGCTCCGAGCGTCGG
ARiS013O12 pGCAP10 TGGCGCCCGAGTGCACTGAAGATGGCGGCTGCTGTAGGACGGTTGCTCCGAGCGTCGGTT
ARiS020J06 pGCAP10 GGTGGCNCCCGAGTGCACTGAAGATGGCGGCTGCTGTAGGACGGTTGCTCCGAGCGTCGG
ARiS020N17 pGCAP10 GGCGCCCGAGTGCACTGAAGATGGCGGCTGCTGTAGGACGGTTGCTCCGAGCGTCGGTTG
ARiS023B19 pGCAP10 GCTCTGCCCGCCCCGTGGCGCCCGAGTGCACTGAAGATGGCGGCTGCTGTAGGACGGTTG
ARiS045O20 pGCAP10 GGCCCCGTGGCGCCCGAGTGCACTGAAGATGGCGGCTGCTGTAGGACGGTTGCTCCGAGC
ARiS055G06 pGCAP10 GCTCTGCCCGCCCCGTGGCGCCCGAGTGCACTGAAGATGGCGGCTGCTGTAGGACGGTTG
ARiS085H04 pGCAP10 GGAGTGCACTGAAGATGGCGGCTGCTGTAGGACGGTTGCTCCGAGCGTCGGTTGCCCGAC
ARiS109J01 pGCAP10 GGTGGCGCCCGAGTGCACTGAAGATGGCGGCTGCTGTAGGACGGTTGCTCCGAGCGTCGG
RBb44G09 pGCAP1
RBb48D03 pGCAP1 GGCACTGAAGATGGCGGCTGCTGTAGGACGGTTGCTCCGAGCGTCGGTTGCCCGACATGT
RBd02F06 pGCAP10 GGCCCCGTGGCGCCCGAGTGCACTGAAGATGGCGGCTGCTGTAGGACGGTTGCTCCGAGC
RBd19D06 pGCAP10 GCTCTGCCCGCCCCGTGGCGCCCGAGTGCACTGAAGATGGCGGCTGCTGTAGGACGGTTG
RBd53D07 pGCAP10 GAGTGTGCACTGAAGATGGCGGCTGCTGTAGGACGGTTGCTCCGAGCGTCGGTTGCCCGA
RBd65E08 pGCAP10 GGTCTCTGCCCGCCCCGTGGCGCCCGAGTGCACTGAAGATGGCGGCTGCTGTAGGACGGT
RBd78A06 pGCAP10 GAGATGGCGGCTGCTGTAGGACGGTTGCTCCGAGCGTCGGTTGCCCGACATGTGAGTGCC
RBd79C06 pGCAP10 GGGTGGCGCCCGAGTGCACTGAAGATGGCGGCTGCTGTAGGACGGTTGCTCCGAGCGTCG
RBd85F01 pGCAP10 GGTCTCTGCCCGCCCCGTGGCGCCCGAGTGCACTGAAGATGGCGGCTGCTGTAGGACGGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl