Prev. |  KEGG KO K20011 > 

RIKEN DNA Bank Human Resource - PRDX3

Gene ID NCBI Gene 10935 |  KEGG hsa:10935
Gene Symbol PRDX3
Protein Name peroxiredoxin 3
Synonyms AOP-1|AOP1|HBC189|MER5|PRO1748|SP-22|prx-III
Ortholog resources KEGG ortholog (KEGG orthology K20011) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY085095 IRAL012M07 pOTB7 BC002685 NM_006793 Full
HGY086418 IRAL016A18 pDNR-LIB BC007062 NM_006793 Full
HGY088539 IRAL021F19 pDNR-LIB BC059169 NM_006793 Full
HGY088709 IRAL021M21 pDNR-LIB BC008435 NM_006793 Full/var
HGY088733 IRAL021N21 pDNR-LIB BC009601 NM_006793 Full
HGY092616 IRAL031I24 pDNR-LIB BC021691 NM_006793 Full
HGY095113 IRAL037N01 pDNR-LIB BC022373 NM_006793 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE021327 W01A053F07 pENTR-TOPO IRAL016A18 BC007062 NM_006793  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR050883 ARe27D11 pKA1U5 NM_006793.2  
GGAGTGCACTGAAGATGGCGGCTGCTGTAGGACGGTTGCTCCGAGCGTCGGTTGCCCGAC
HKR071345 ARe78G01 pKA1U5 NM_006793.2  
GACTGAAGATGGCGGCTGCTGTAGGACGGTTGCTCCGAGCGTCGGTTGCCCGACATGTGA
HKR072980 ARe82H12 pKA1U5 NM_006793.2  
GGTGGCGCCCGAGTGCACTGAAGATGGCGGCTGCTGTAGGACGGTTGCTCCGAGCGTCGG
HKR082526 ARf06F06 pKA1U5 NM_006793.2  
GGTGGCGCCCGAGNTGCACTGAAGATGGCGGCTGCTGTTAGGACGGTTGCTCCGAGCGTC
HKR164524 ARi11F04 pGCAP10 NM_006793.2  
GGCCCGAGTGCACTGAAGATGGCGGCTGCTGTAGGACGGTTGCTCCGAGCGTCGGTTGCC
HKR165771 ARi14H03 pGCAP10 NM_006793.2  
GGAGTGCACTGAAGATGGCGGCTGCTGTAGGACGGTTGCTCCGAGCGTCGGTTGCCCGAC
HKR180825 ARi52B01 pGCAP10 NM_006793.2  
GTCAGACTTAACTAAGCAGATTTCCCGAGACTACGGTGTGCTGTTAGAAGGTTCTGGTCT
HKR188127 ARi70F07 pGCAP10 NM_006793.2  
GGTGGCGCCCGAGTGCACTGAAGATGGCGGCTGCTGTAGGACGGTTGCTCCGAGCGTCGG
HKR205548 ARiS013O12 pGCAP10 NM_006793.2  
TGGCGCCCGAGTGCACTGAAGATGGCGGCTGCTGTAGGACGGTTGCTCCGAGCGTCGGTT
HKR208222 ARiS020J06 pGCAP10 NM_006793.2  
GGTGGCNCCCGAGTGCACTGAAGATGGCGGCTGCTGTAGGACGGTTGCTCCGAGCGTCGG
HKR208329 ARiS020N17 pGCAP10 NM_006793.2  
GGCGCCCGAGTGCACTGAAGATGGCGGCTGCTGTAGGACGGTTGCTCCGAGCGTCGGTTG
HKR209243 ARiS023B19 pGCAP10 NM_006793.2  
GCTCTGCCCGCCCCGTGGCGCCCGAGTGCACTGAAGATGGCGGCTGCTGTAGGACGGTTG
HKR218356 ARiS045O20 pGCAP10 NM_006793.2  
GGCCCCGTGGCGCCCGAGTGCACTGAAGATGGCGGCTGCTGTAGGACGGTTGCTCCGAGC
HKR222150 ARiS055G06 pGCAP10 NM_006793.2  
GCTCTGCCCGCCCCGTGGCGCCCGAGTGCACTGAAGATGGCGGCTGCTGTAGGACGGTTG
HKR234172 ARiS085H04 pGCAP10 NM_006793.2  
GGAGTGCACTGAAGATGGCGGCTGCTGTAGGACGGTTGCTCCGAGCGTCGGTTGCCCGAC
HKR243817 ARiS109J01 pGCAP10 NM_006793.2  
GGTGGCGCCCGAGTGCACTGAAGATGGCGGCTGCTGTAGGACGGTTGCTCCGAGCGTCGG
HKR337753 RBb44G09 pGCAP1 NM_006793.2  
HKR339275 RBb48D03 pGCAP1 NM_006793.2  
GGCACTGAAGATGGCGGCTGCTGTAGGACGGTTGCTCCGAGCGTCGGTTGCCCGACATGT
HKR360926 RBd02F06 pGCAP10 NM_006793.2  
GGCCCCGTGGCGCCCGAGTGCACTGAAGATGGCGGCTGCTGTAGGACGGTTGCTCCGAGC
HKR367678 RBd19D06 pGCAP10 NM_006793.2  
GCTCTGCCCGCCCCGTGGCGCCCGAGTGCACTGAAGATGGCGGCTGCTGTAGGACGGTTG
HKR381279 RBd53D07 pGCAP10 NM_006793.2  
GAGTGTGCACTGAAGATGGCGGCTGCTGTAGGACGGTTGCTCCGAGCGTCGGTTGCCCGA
HKR386104 RBd65E08 pGCAP10 NM_006793.2  
GGTCTCTGCCCGCCCCGTGGCGCCCGAGTGCACTGAAGATGGCGGCTGCTGTAGGACGGT
HKR391206 RBd78A06 pGCAP10 NM_006793.2  
GAGATGGCGGCTGCTGTAGGACGGTTGCTCCGAGCGTCGGTTGCCCGACATGTGAGTGCC
HKR391654 RBd79C06 pGCAP10 NM_006793.2  
GGGTGGCGCCCGAGTGCACTGAAGATGGCGGCTGCTGTAGGACGGTTGCTCCGAGCGTCG
HKR394121 RBd85F01 pGCAP10 NM_006793.2  
GGTCTCTGCCCGCCCCGTGGCGCCCGAGTGCACTGAAGATGGCGGCTGCTGTAGGACGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl