Prev. | NRCD Clone W | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03358

HP ID(1) HP03358
Gene ID(2) 7456
Gene Symbol finder WIPF1
Protein Name WAS/WASL interacting protein family, member 1
RefSeq NM_001077269.1
Length of RefSeq (bp) 4664
Chromosome 2q31.1
Reference DDBJ accession
UniGene Hs.128067

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe86H07 pKA1U5 TGGGGTCGCAGCCTCCCGGCGCTGAGCGCTTTTCCTGCCCGCCCGGCTCAGCCCTGCGGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl