Prev. |  KEGG KO K19475 > 

RIKEN DNA Bank Human Resource - WIPF1

Gene ID NCBI Gene 7456 |  KEGG hsa:7456
Gene Symbol WIPF1
Protein Name WAS/WASL interacting protein family member 1
Synonyms PRPL-2|WAS2|WASPIP|WIP
Featured content Endocytosis (human)
Ortholog resource in our bank

  WIPF1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY042605 IRAK106I13 pBluescript BC045584 NM_003387
HGY086014 IRAL015A14 pOTB7 BC002914 NM_003387 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR074575 ARe86H07 pKA1U5 NM_001077269.1  
TGGGGTCGCAGCCTCCCGGCGCTGAGCGCTTTTCCTGCCCGCCCGGCTCAGCCCTGCGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl