Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03345

HP ID(1) HP03345
Gene ID(2) 56902
Gene Symbol finder PNO1
Protein Name partner of NOB1 homolog (S. cerevisiae)
RefSeq NM_020143.2
Length of RefSeq (bp) 1994
Chromosome 2p14
Reference DDBJ accession
UniGene Hs.262858

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS110C16 pGCAP10 GCTGCGTGGTGCAGCTGCGCACGTGTTTCAGCCGGCAGCGCTTTAAGATTTCCGGGGATG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl