Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS110C16

Clone ID RBdS110C16
HP ID HP03345
Gene ID 56902
Gene Symbol PNO1
Protein Name partner of NOB1 homolog (S. cerevisiae)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_020143.2
Length of RefSeq (bp) 1994
Chromosome 2p14
Reference DDBJ accession
UniGene Hs.262858
5'-terminal sequence GCTGCGTGGTGCAGCTGCGCACGTGTTTCAGCCGGCAGCGCTTTAAGATTTCCGGGGATG
2011.08.28