Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03328

HP ID(1) HP03328
Gene ID(2) 10607
Gene Symbol finder TBL3
Protein Name transducin (beta)-like 3
RefSeq NM_006453.2
Length of RefSeq (bp) 2618
Chromosome 16p13.3
Reference DDBJ accession
UniGene Hs.513267

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS083K02 pGCAP10 GGTTCTGTGAAGAGTTCGGTGCTAACCTCCCTCACGCGGCGGTGGCTGCCGGGACCCTAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl