Prev. |  KEGG KO K14555 > 

RIKEN DNA Bank Human Resource - TBL3

Gene ID NCBI Gene 10607 |  KEGG hsa:10607
Gene Symbol TBL3
Protein Name transducin beta like 3
Synonyms SAZD|UTP13
Ortholog resource in our bank

  TBL3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX007821 IRAK019J05 pCMV-SPORT6 BC010231 NM_006453
HGX021067 IRAK052L03 pCMV-SPORT6 BC035409 NM_006453 Full/var
HGY091371 IRAL028H03 pOTB7 BC014007 NM_006453 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR433442 RBdS083K02 pGCAP10 NM_006453.2  
GGTTCTGTGAAGAGTTCGGTGCTAACCTCCCTCACGCGGCGGTGGCTGCCGGGACCCTAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl