Prev. | NRCD Clone Y | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03321

HP ID(1) HP03321
Gene ID(2) 7533
Gene Symbol finder YWHAH
Protein Name tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide
RefSeq NM_003405.3
Length of RefSeq (bp) 1807
Chromosome 22q12.3
Reference DDBJ accession
UniGene Hs.226755

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS023E07 pGCAP10 GGTCCGCGGCGCGAGCCACAGCGCGCGGGGCGAGCCAGCGAGAGGGCGCGAGCGGCGGCG
ARiS150G08 pGCAP10 GCCACAGCGCGCGGGGCGNNCCAGCGAGAGGGCGCGAGCGGCGGCGCTGCCTGCAGCCTG
RBb59G09 pGCAP1 GCGACCGGGGAGCGGACTGACCGGCGGGAGGGCTAGCGAGCCAGCGGTGTGAGGCGCGAG
RBd16C05 pGCAP10 GACAGCGCGCGGGGCGAGCCAGCGAGAGGGCGCGAGCGGCGGCGCTGCCTGCAGCCTGCA
RBd80G11 pGCAP10 GGTTGTCCNCGGCGCGAGCCACAGCGCGCGGGGCGAGCCAGCGAGAGGGCGCGAGCGGCG
RBdS104E01 pGCAP10 GGTTGTCCGCGGCGCGAGCCACAGCGCGCGGGGCGAGCCAGCGAGAGGGCGCGAGCGGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl