Prev. |  KEGG KO K16198 > 

RIKEN DNA Bank Human Resource - YWHAH

Gene ID NCBI Gene 7533 |  KEGG hsa:7533
Gene Symbol YWHAH
Protein Name tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta
Synonyms YWHA1
Featured content Rb pathway
Featured content Hippo signaling (human)
Ortholog resource in our bank

  YWHAH

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083364 IRAL008G20 pOTB7 BC003047 NM_003405 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE005025 W01A012J09 pENTR-TOPO IRAL008G20 BC003047 NM_003405  
HGE005031 W01A012J15 pENTR-TOPO IRAL008G20 BC003047 NM_003405  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR209303 ARiS023E07 pGCAP10 NM_003405.3  
GGTCCGCGGCGCGAGCCACAGCGCGCGGGGCGAGCCAGCGAGAGGGCGCGAGCGGCGGCG
HKR260152 ARiS150G08 pGCAP10 NM_003405.3  
GCCACAGCGCGCGGGGCGNNCCAGCGAGAGGGCGCGAGCGGCGGCGCTGCCTGCAGCCTG
HKR343753 RBb59G09 pGCAP1 NM_003405.3  
GCGACCGGGGAGCGGACTGACCGGCGGGAGGGCTAGCGAGCCAGCGGTGTGAGGCGCGAG
HKR366453 RBd16C05 pGCAP10 NM_003405.3  
GACAGCGCGCGGGGCGAGCCAGCGAGAGGGCGCGAGCGGCGGCGCTGCCTGCAGCCTGCA
HKR392155 RBd80G11 pGCAP10 NM_003405.3  
GGTTGTCCNCGGCGCGAGCCACAGCGCGCGGGGCGAGCCAGCGAGAGGGCGCGAGCGGCG
HKR441697 RBdS104E01 pGCAP10 NM_003405.3  
GGTTGTCCGCGGCGCGAGCCACAGCGCGCGGGGCGAGCCAGCGAGAGGGCGCGAGCGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl