Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03305

HP ID(1) HP03305
Gene ID(2) 5423
Gene Symbol finder POLB
Protein Name polymerase (DNA directed), beta
RefSeq NM_002690.1
Length of RefSeq (bp) 1259
Chromosome 8p11.2
Reference DDBJ accession
UniGene Hs.654484

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd05A07 pGCAP10 GATTGTTCCGCCGGTCGCGCCGGAGCTGGGTTGCTCCTGCTCCCGTCTCCAAGTCCTGGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl