Prev. |  KEGG KO K02330 > 

RIKEN DNA Bank Human Resource - POLB

Gene ID NCBI Gene 5423 |  KEGG hsa:5423
Gene Symbol POLB
Protein Name DNA polymerase beta
Synonyms -
Featured content DNA repair (human)
Ortholog resource in our bank

  POLB

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR362007 RBd05A07 pGCAP10 NM_002690.1  
GATTGTTCCGCCGGTCGCGCCGGAGCTGGGTTGCTCCTGCTCCCGTCTCCAAGTCCTGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl