Prev. | Human A to Z list > P > 

RIKEN DNA Bank Human Resource - POLB

Gene ID (NCBI) 5423
Gene Symbol POLB
Protein Name DNA polymerase beta
Synonyms -
Databases KEGG hsa:5423 |  NCBI Gene 5423
Featured content DNA repair (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K02330)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR362007 RBd05A07 pGCAP10 NM_002690.1  
GATTGTTCCGCCGGTCGCGCCGGAGCTGGGTTGCTCCTGCTCCCGTCTCCAAGTCCTGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl