Prev. | NRCD Clone O | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03298

HP ID(1) HP03298
Gene ID(2) 94101
Gene Symbol finder ORMDL1
Protein Name ORM1-like 1 (S. cerevisiae)
RefSeq NM_016467.4
Length of RefSeq (bp) 2185
Chromosome 2q32
Reference DDBJ accession
UniGene Hs.709387

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe67H05 pKA1U5 TGGTGTATCCGCGGCCGTAGCAGCCGGGCTGGTCCTGCTGCGAGCCGGCGGCCCGGAGTG
RBb11B08 pKA1U5 CGTCGGTCTAGCAGGGGGGACTCCCCTGAGGGGCCGCTGCGGGTCGCCGTCTTCGGAGGC
RBb49G10 pGCAP1 GGGGCGCGTATCCGCGGCCGNTANCAGCCGGGCTGGTCCTGCCTTTTAGNCGGCGGNCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl