Prev. | 

RIKEN DNA Bank Human Resource - ORMDL1

Gene ID NCBI Gene 94101 |  KEGG hsa:94101
Gene Symbol ORMDL1
Protein Name ORMDL sphingolipid biosynthesis regulator 1
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086477 IRAL016D05 pDNR-LIB BC005200 NM_016467 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR066973 ARe67H05 pKA1U5 NM_016467.4  
TGGTGTATCCGCGGCCGTAGCAGCCGGGCTGGTCCTGCTGCGAGCCGGCGGCCCGGAGTG
HKR324432 RBb11B08 pKA1U5 NM_016467.4  
CGTCGGTCTAGCAGGGGGGACTCCCCTGAGGGGCCGCTGCGGGTCGCCGTCTTCGGAGGC
HKR339754 RBb49G10 pGCAP1 NM_016467.4  
GGGGCGCGTATCCGCGGCCGNTANCAGCCGGGCTGGTCCTGCCTTTTAGNCGGCGGNCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl