Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03290

HP ID(1) HP03290
Gene ID(2) 29920
Gene Symbol finder PYCR2
Protein Name pyrroline-5-carboxylate reductase family, member 2
RefSeq NM_013328.2
Length of RefSeq (bp) 1708
Chromosome 1q42.12
Reference DDBJ accession
UniGene Hs.654718

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARh02E01 pGCAP1 GAGCCGCCCGGGAGATATCCGCCGGGGGAGAATAGGGTTGCACCATCCCAGAAGC
RBd42G11 pGCAP10 GTGCTGTTAGCTCGCCGGTCCTCGGCACGCCGCCCGTTCGCCCCTGCGCTGTCCGCCCTT
RBdS007B19 pGCAP10 GGAGAATAGGGTTGCACCATCCCAGAAGCTGCTGTTAGCTCGCCGGTCCTCGGCACGCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl