Prev. |  KEGG KO K00286 > 

RIKEN DNA Bank Human Resource - PYCR2

Gene ID NCBI Gene 29920 |  KEGG hsa:29920
Gene Symbol PYCR2
Protein Name pyrroline-5-carboxylate reductase 2
Synonyms HLD10|P5CR2
Ortholog resources KEGG ortholog (KEGG orthology K00286) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008003 IRAK020A03 pCMV-SPORT6 BC020553 NM_013328
HGX010456 IRAK026C08 pCMV-SPORT6 BC014868 NM_013328 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR120897 ARh02E01 pGCAP1 NM_013328.2  
GAGCCGCCCGGGAGATATCCGCCGGGGGAGAATAGGGTTGCACCATCCCAGAAGC
HKR376955 RBd42G11 pGCAP10 NM_013328.2  
GTGCTGTTAGCTCGCCGGTCCTCGGCACGCCGCCCGTTCGCCCCTGCGCTGTCCGCCCTT
HKR402843 RBdS007B19 pGCAP10 NM_013328.2  
GGAGAATAGGGTTGCACCATCCCAGAAGCTGCTGTTAGCTCGCCGGTCCTCGGCACGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl