Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03276

HP ID(1) HP03276
Gene ID(2) 7327
Gene Symbol finder UBE2G2
Protein Name ubiquitin-conjugating enzyme E2G 2 (UBC7 homolog, yeast)
RefSeq NM_003343.4
Length of RefSeq (bp) 2919
Chromosome 21q22.3
Reference DDBJ accession
UniGene Hs.529420

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS132K15 pGCAP10 GAGTCCCCGGTGTCGGGGCAGGAGGCACGCGCGCGGCTGAGGCGAGGTCGCTCGGCGCAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl