Prev. |  KEGG KO K04555 > 

RIKEN DNA Bank Human Resource - UBE2G2

Gene ID NCBI Gene 7327 |  KEGG hsa:7327
Gene Symbol UBE2G2
Protein Name ubiquitin conjugating enzyme E2 G2
Synonyms UBC7
Ortholog resources KEGG ortholog (KEGG orthology K04555) in the DNA Bank
Featured content Parkinson disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083569 IRAL008P09 pOTB7 BC001738 NM_182688 Full
HGY089432 IRAL023J16 pOTB7 BC008351 NM_182688 Full
HGY091615 IRAL029A15 pOTB7 BC011569 NM_182688 Full
HGY093321 IRAL033F01 pOTB7 BC017241 NM_182688

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE097621 M01C044A21 pDONR221 MGC11-E11 BC001738 NM_182688  
HGE097669 M01C044C21 pDONR221 MGC11-E11 BC001738 NM_182688  
HGE097717 M01C044E21 pDONR221 MGC11-E11 BC001738 NM_182688  
HGE097765 M01C044G21 pDONR221 MGC11-E11 BC001738 NM_182688  
HGE097813 M01C044I21 pDONR221 MGC11-E11 BC001738 NM_182688  
HGE097861 M01C044K21 pDONR221 MGC11-E11 BC001738 NM_182688  
HGE097909 M01C044M21 pDONR221 MGC11-E11 BC001738 NM_182688  
HGE097957 M01C044O21 pDONR221 MGC11-E11 BC001738 NM_182688  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR453055 RBdS132K15 pGCAP10 NM_003343.4  
GAGTCCCCGGTGTCGGGGCAGGAGGCACGCGCGCGGCTGAGGCGAGGTCGCTCGGCGCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl