Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03275

HP ID(1) HP03275
Gene ID(2) 25828
Gene Symbol finder TXN2
Protein Name thioredoxin 2
RefSeq NM_012473.3
Length of RefSeq (bp) 1342
Chromosome 22q13.1
Reference DDBJ accession
UniGene Hs.211929

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe41F04 pKA1U5 GATCCCTCCGCTCGCATTGCAGGGAGATGGCTCCCNTACTTCTTCTGAGGAGGTTCCTGG
RBb21A02 pKA1U5 GAGGCGTGCCCTTGACAGGCAGGGAGGGCTAGGCTGTGCATCCCTCCGCTCGCATTGCAG
RBdS014G17 pGCAP10 GAGGCAGGGAGGGCTAGGCTGTGCATCCCTCCGCTCGCATTGCAGGGAGATGGCTCAGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl