DNA Bank Top |  KEGG KO K03671 > 

RIKEN DNA Bank Human Resource - TXN2

Gene ID NCBI Gene 25828 |  KEGG hsa:25828
Gene Symbol TXN2
Protein Name thioredoxin 2
Synonyms COXPD29|MT-TRX|MTRX|TRX2|TXN

Link

Ortholog resource in our bank

  TXN2


External database

human TXN2

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB03713 SEREX clone NGO-St-032 (ID 251) #1 SEREX clone NGO-St-032 (ID 251) #1    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001539 IRAK003O03 pCMV-SPORT6 BC013726 NM_012473 Full
HGX044214 IRAK110I22 pCMV-SPORT6 BC050610 NM_012473 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR056524 ARe41F04 pKA1U5 NM_012473.3  
GATCCCTCCGCTCGCATTGCAGGGAGATGGCTCCCNTACTTCTTCTGAGGAGGTTCCTGG
HKR328402 RBb21A02 pKA1U5 NM_012473.3  
GAGGCGTGCCCTTGACAGGCAGGGAGGGCTAGGCTGTGCATCCCTCCGCTCGCATTGCAG
HKR405761 RBdS014G17 pGCAP10 NM_012473.3  
GAGGCAGGGAGGGCTAGGCTGTGCATCCCTCCGCTCGCATTGCAGGGAGATGGCTCAGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.09.27

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl