Prev. | NRCD Clone Y | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03219

HP ID(1) HP03219
Gene ID(2) 90522
Gene Symbol finder YIF1B
Protein Name Yip1 interacting factor homolog B (S. cerevisiae)
RefSeq NM_001039672.1
Length of RefSeq (bp) 1242
Chromosome 19q13.2
Reference DDBJ accession
UniGene Hs.280741

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS161B09 pGCAP10 GAGGTGGCGGCGGCGAAGGATGCACCCGGCAGGCTTGGCGGCGGCGGCTGCGGGGACGCC
RBb06B12 pKA1U5 GGGTACGGGAGCCGGGCGGGCACGCTCCGAACCGCGGCTTAGGTGGCGGCGGCGAAGGAT
RBb65E05 pGCAP1 AAATGTGAGGTGGCGGCGGCGAAGGATGCACCCGGCAGGCTTGGCGGCGGCGGCTGCGGG
RBd42H12 pGCAP10 GGTCACTGCAGGTCAGAGGTCACGAGATCAAGGATCTGGAACCCTGAGGTGTGCACAGCG
RBdS075I13 pGCAP10 GGGGCACGCTCCGAACCGCGGCTTAGGTGGCGGCGGCGAAGGATGCACCCGGCAGGCTTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl