Prev. |  KEGG KO K20362 > 

RIKEN DNA Bank Human Resource - YIF1B

Gene ID NCBI Gene 90522 |  KEGG hsa:90522
Gene Symbol YIF1B
Protein Name Yip1 interacting factor homolog B, membrane trafficking protein
Synonyms FinGER8
Ortholog resources KEGG ortholog (KEGG orthology K20362) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY089413 IRAL023I21 pOTB7 BC007644 NM_033557 Full
HGY093814 IRAL034I22 pOTB7 BC014974 NM_033557

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR264433 ARiS161B09 pGCAP10 NM_001039672.1  
GAGGTGGCGGCGGCGAAGGATGCACCCGGCAGGCTTGGCGGCGGCGGCTGCGGGGACGCC
HKR322436 RBb06B12 pKA1U5 NM_001039672.1  
GGGTACGGGAGCCGGGCGGGCACGCTCCGAACCGCGGCTTAGGTGGCGGCGGCGAAGGAT
HKR346101 RBb65E05 pGCAP1 NM_001039672.1  
AAATGTGAGGTGGCGGCGGCGAAGGATGCACCCGGCAGGCTTGGCGGCGGCGGCTGCGGG
HKR376980 RBd42H12 pGCAP10 NM_001039672.1  
GGTCACTGCAGGTCAGAGGTCACGAGATCAAGGATCTGGAACCCTGAGGTGTGCACAGCG
HKR430205 RBdS075I13 pGCAP10 NM_001039672.1  
GGGGCACGCTCCGAACCGCGGCTTAGGTGGCGGCGGCGAAGGATGCACCCGGCAGGCTTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl