Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03214

HP ID(1) HP03214
Gene ID(2) 10783
Gene Symbol finder NEK6
Protein Name NIMA (never in mitosis gene a)-related kinase 6
RefSeq NM_014397.5
Length of RefSeq (bp) 2645
Chromosome 9q33.3
Reference DDBJ accession
UniGene Hs.197071

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe05C09 pKA1U5 GGGGCCCGCGCAGGCGGTGGCGGCGGCGGCGGAACCNTAGCTGACGGGCGNTGCGGCCGC
ARe31H07 pKA1U5 GGTGTGGGACGCACCGCTCCAGCCGCCCGCGGGCCANCGCACCGGTCCCCCAGCGGCAGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl