DNA Bank Top |  KEGG KO K20875 > 

RIKEN DNA Bank Human Resource - NEK6

Gene ID NCBI Gene 10783 |  KEGG hsa:10783
Gene Symbol NEK6
Protein Name NIMA related kinase 6
Synonyms SID6-1512
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.

Link

Ortholog resource in our bank

  NEK6


External database

human NEK6

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB15164 pcNDA3-hNEK6 Expression vector of human NIMA related kinase 6 (NEK6) (full-length,1-313aa), HA-tag.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081144 IRAL002O08 pOTB7 BC004174 NM_014397 Full
HGY082956 IRAL007G12 pOTB7 BC000101 NM_014397 Full
HGY084193 IRAL010I01 pOTB7 BC004209 NM_014397 Full
HGY089794 IRAL024I02 pOTB7 BC012761 NM_014397

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE014234 W01A035J18 pENTR-TOPO IRAL007G12 BC000101 NM_014397  
HGE014238 W01A035J22 pENTR-TOPO IRAL007G12 BC000101 NM_014397  
HGE014240 W01A035J24 pENTR-TOPO IRAL007G12 BC000101 NM_014397  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR042057 ARe05C09 pKA1U5 NM_014397.5  
GGGGCCCGCGCAGGCGGTGGCGGCGGCGGCGGAACCNTAGCTGACGGGCGNTGCGGCCGC
HKR052575 ARe31H07 pKA1U5 NM_014397.5  
GGTGTGGGACGCACCGCTCCAGCCGCCCGCGGGCCANCGCACCGGTCCCCCAGCGGCAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.09.24

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl