Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03206

HP ID(1) HP03206
Gene ID(2) 8834
Gene Symbol finder TMEM11
Protein Name transmembrane protein 11
RefSeq NM_003876.2
Length of RefSeq (bp) 1396
Chromosome 17p11.2
Reference DDBJ accession
UniGene Hs.719186

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi33D05 pGCAP10 GAGAGTGTCTCCAAGATGGCCGCTTGGGGAAGGAGGCGTCTTGGCCCGGGCAGCAGTGGC
RBd92C02 pGCAP10 GGGCAAGCAGAGTGTCTCCAAGATGGCCGCTTGGGGAAGGAGGCGTCTTGGCCCGGGCAG
RBdS104M15 pGCAP10 GGTCTCCAAGATGGCCGCTTGGGGAAGGAGGCGTCTTGGCCCGGGCAGCAGTGGCGGCAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl