Prev. | 

RIKEN DNA Bank Human Resource - TMEM11

Gene ID NCBI Gene 8834 |  KEGG hsa:8834
Gene Symbol TMEM11
Protein Name transmembrane protein 11
Synonyms C17orf35|PM1|PMI
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084932 IRAL012F12 pOTB7 BC002819 NM_003876 Full
HGY086536 IRAL016F16 pDNR-LIB BC005268 NM_003876 Full
HGY094466 IRAL036C18 pDNR-LIB BC020815 NM_003876 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE004753 W01A011O17 pENTR-TOPO IRAL012F12 BC002819 NM_003876  
HGE004755 W01A011O19 pENTR-TOPO IRAL012F12 BC002819 NM_003876  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR173277 ARi33D05 pGCAP10 NM_003876.2  
GAGAGTGTCTCCAAGATGGCCGCTTGGGGAAGGAGGCGTCTTGGCCCGGGCAGCAGTGGC
HKR396850 RBd92C02 pGCAP10 NM_003876.2  
GGGCAAGCAGAGTGTCTCCAAGATGGCCGCTTGGGGAAGGAGGCGTCTTGGCCCGGGCAG
HKR441903 RBdS104M15 pGCAP10 NM_003876.2  
GGTCTCCAAGATGGCCGCTTGGGGAAGGAGGCGTCTTGGCCCGGGCAGCAGTGGCGGCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl