Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03203

HP ID(1) HP03203
Gene ID(2) 4706
Gene Symbol finder NDUFAB1
Protein Name NADH dehydrogenase (ubiquinone) 1, alpha/beta subcomplex, 1, 8kDa
RefSeq NM_005003.2
Length of RefSeq (bp) 804
Chromosome 16p12.1
Reference DDBJ accession
UniGene Hs.189716

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe08E05 pKA1U5 GGCAGTGCATCCTGGGTTGGCGTAGCCATGGCGTCTCGATGTCCTTTCAGCCTATGTCAG
ARe13F05 pKA1U5 GGCAGTGCATCCTGGGTTGGCGTAGCCATGGCGTCTCGTGTCCTTTCAGCCTATGTCAGC
ARe76F01 pKA1U5 GGGGTTGGCGCTAACCATGGCGTCTCGTGTCCTCCTTTTANTATGTCAGCCGCCTGCCCG
ARi21E01 pGCAP10 GAGTGCATCCTGGGTTGGCGTAGCCATGGCGTCTCGTGTCCTTTCAGCCTATGTCAGCCG
ARiS109F19 pGCAP10 GAGTGCATCCTGGGTTGGCGTAGCCATGGCGTCTCGTGTCCTTTCAGCCTATGTCAGCCG
RBd05D05 pGCAP10 GAGCCATGGCGTCTCGTGTCCTTTCAGCCTATGTCAGCCGCCTGCCCGCGGCCTTTGCGC
RBd58C07 pGCAP10 GGCAGTGCATCCTGGGTTGGCGTAGCCATGGCGTCTCGTGTCCTTTCAGCCTATGTCAGC
RBd66B04 pGCAP10 GGCAGTGCATCCTGGGTTGGCGTAGCCATGGCGTCTCGTGTCCTTTCAGCCTATGTCAGC
RBd66H02 pGCAP10 GACTCAGATGATAGTGACGAATGTCTGGCAGTGAGGACACATTTTGGCATTCTTGCTGAC
RBd78C12 pGCAP10 GGCAGTGCATCCTGGGTTGGCGTAGCCATGGCGTCTCGTGTCCTTTCAGCCTATGTCAGC
RBd84D08 pGCAP10 GCCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTC
RBd84D09 pGCAP10 GGCCGCCGGAAAGGAACCCTGGTCCGGAGGCGGCGGCGCAGTGCATCCTGGGTTGGCGTA
RBdS075C11 pGCAP10 GAGTGCNTCCTGGGTTGGCGTAGCCATGGCGTCTCGTGTCCTTTCAGCCTATGTCAGCCG
RBdS104A14 pGCAP10 GAGCCGCCTGCCCGCGGCCTTTGCGCCGCTGCCCCGGGTCCGGATGCTGGCCGTGGCCCG
RBdS105N22 pGCAP10 GGTAGCCATGGCGTCTCGTGTCCTTTCAGCCTATGTCAGCCGCCTGCCCGCGGCCTTTGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl