Prev. |  KEGG KO K03955 > 

RIKEN DNA Bank Human Resource - NDUFAB1

Gene ID NCBI Gene 4706 |  KEGG hsa:4706
Gene Symbol NDUFAB1
Protein Name NADH:ubiquinone oxidoreductase subunit AB1
Synonyms ACP|ACP1|FASN2A|SDAP
Ortholog resources KEGG ortholog (KEGG orthology K03955) in the DNA Bank
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX047925 IRAK119N13 pCMV-SPORT6 BC058920 NM_005003 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR043301 ARe08E05 pKA1U5 NM_005003.2  
GGCAGTGCATCCTGGGTTGGCGTAGCCATGGCGTCTCGATGTCCTTTCAGCCTATGTCAG
HKR045325 ARe13F05 pKA1U5 NM_005003.2  
GGCAGTGCATCCTGGGTTGGCGTAGCCATGGCGTCTCGTGTCCTTTCAGCCTATGTCAGC
HKR070521 ARe76F01 pKA1U5 NM_005003.2  
GGGGTTGGCGCTAACCATGGCGTCTCGTGTCCTCCTTTTANTATGTCAGCCGCCTGCCCG
HKR168497 ARi21E01 pGCAP10 NM_005003.2  
GAGTGCATCCTGGGTTGGCGTAGCCATGGCGTCTCGTGTCCTTTCAGCCTATGTCAGCCG
HKR243739 ARiS109F19 pGCAP10 NM_005003.2  
GAGTGCATCCTGGGTTGGCGTAGCCATGGCGTCTCGTGTCCTTTCAGCCTATGTCAGCCG
HKR362077 RBd05D05 pGCAP10 NM_005003.2  
GAGCCATGGCGTCTCGTGTCCTTTCAGCCTATGTCAGCCGCCTGCCCGCGGCCTTTGCGC
HKR383255 RBd58C07 pGCAP10 NM_005003.2  
GGCAGTGCATCCTGGGTTGGCGTAGCCATGGCGTCTCGTGTCCTTTCAGCCTATGTCAGC
HKR386428 RBd66B04 pGCAP10 NM_005003.2  
GGCAGTGCATCCTGGGTTGGCGTAGCCATGGCGTCTCGTGTCCTTTCAGCCTATGTCAGC
HKR386570 RBd66H02 pGCAP10 NM_005003.2  
GACTCAGATGATAGTGACGAATGTCTGGCAGTGAGGACACATTTTGGCATTCTTGCTGAC
HKR391260 RBd78C12 pGCAP10 NM_005003.2  
GGCAGTGCATCCTGGGTTGGCGTAGCCATGGCGTCTCGTGTCCTTTCAGCCTATGTCAGC
HKR393680 RBd84D08 pGCAP10 NM_005003.2  
GCCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTC
HKR393681 RBd84D09 pGCAP10 NM_005003.2  
GGCCGCCGGAAAGGAACCCTGGTCCGGAGGCGGCGGCGCAGTGCATCCTGGGTTGGCGTA
HKR430059 RBdS075C11 pGCAP10 NM_005003.2  
GAGTGCNTCCTGGGTTGGCGTAGCCATGGCGTCTCGTGTCCTTTCAGCCTATGTCAGCCG
HKR441614 RBdS104A14 pGCAP10 NM_005003.2  
GAGCCGCCTGCCCGCGGCCTTTGCGCCGCTGCCCCGGGTCCGGATGCTGGCCGTGGCCCG
HKR442334 RBdS105N22 pGCAP10 NM_005003.2  
GGTAGCCATGGCGTCTCGTGTCCTTTCAGCCTATGTCAGCCGCCTGCCCGCGGCCTTTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl