Prev. | NRCD Clone Y | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03172

HP ID(1) HP03172
Gene ID(2) 83719
Gene Symbol finder YPEL3
Protein Name yippee-like 3 (Drosophila)
RefSeq NM_031477.4
Length of RefSeq (bp) 1588
Chromosome 16p11.2
Reference DDBJ accession
UniGene Hs.513491

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe76F10 pKA1U5 GANGCGGGTCCCCTCCCCCTCCCGCCGCAGCGCCCTNAACAGCTGGGCTCGGTGTAAACA
RBd83C12 pGCAP10 GGCCCGCCGCAGCGGCGGCAGCAGCTGGGCTCGGTGTAAACAAGTCCAGGCGCCTGCGAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl