Prev. | 

RIKEN DNA Bank Human Resource - YPEL3

Gene ID NCBI Gene 83719 |  KEGG hsa:83719
Gene Symbol YPEL3
Protein Name yippee like 3
Synonyms -
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX044121 IRAK110F01 pCMV-SPORT6 BC050664 NM_031477 Full
HGY085574 IRAL013P14 pOTB7 BC005009 NM_031477 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR070530 ARe76F10 pKA1U5 NM_031477.4  
GANGCGGGTCCCCTCCCCCTCCCGCCGCAGCGCCCTNAACAGCTGGGCTCGGTGTAAACA
HKR393260 RBd83C12 pGCAP10 NM_031477.4  
GGCCCGCCGCAGCGGCGGCAGCAGCTGGGCTCGGTGTAAACAAGTCCAGGCGCCTGCGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl