Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03162

HP ID(1) HP03162
Gene ID(2) 581
Gene Symbol finder BAX
Protein Name BCL2-associated X protein
RefSeq NM_004324.3
Length of RefSeq (bp) 891
Chromosome 19q13.3-q13.4
Reference DDBJ accession
UniGene Hs.631546

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe48E11 pKA1U5 GGAGAGGCGGCGGCGGGAGCGGCGGTGATGGACGGGTCCGGGGAGCAGCCCAGAGGCGGG
ARe68B01 pKA1U5 GGCGCGGACCCGGCGAGAGGCGGCGGCGGGAGCGGCGGTGATGGACGGGTCCGGGGAGCA
ARe93B12 pKA1U5 ATCCTGGGGCGGGAGCGGCGGTGATGGACGGGTCCGGGGAGCAGCCCAGAGGCGGGGGGC
ARi21B11 pGCAP10 GAGAGGCGGCGGCGGGAGCGGCGGTGATGGACGGGTCCGGGGAGCAGCCCAGAGGCGGGG
ARi57H06 pGCAP10 GGCGCGGACCCGGCGAGAGGCGGCGGCGGGAGCGGCGGTGATGGACGGGTCCGGGGAGCA
ARiS085M07 pGCAP10 CGGCCGGCCGATGGACCCGGGCGCGCTGCGGCCGCCCGCGCGGACCCGGCGAGAGGCGGC
ARiS096L24 pGCAP10 GGAGAGGCGGCGGCGGGAGCGGCGGTGATGGACGGGTCCGGGGAGCAGCCCAGAGGCGGG
RBb56D02 pGCAP1 GGCCGCCCGCGCGGACCCGGCGAGAGGCGGCGGCGGGAGCGGCGGTGATGGACGGCTCTG
RBd39E10 pGCAP10 GGAGAGGCGGCGGCGGGAGCGGCGGTGATGGACGGGGCCCACCAGCTCTGAGCAGATCAT
RBd96E12 pGCAP10 GGAGAGGCGGCGGCGGGAGCGGCGGTGATGGACGGGGCCCACCAGCTCTGAGCAGATCAT
RBdS070E02 pGCAP10 GGCGGCCGCCCGCGCGGACCCGGCGAGAGGCGGCGGCGGGAGCGGCGGTGATGGACGGGG
RBdS110O05 pGCAP10 GACGTGACCCGGGCGCGCTGCGGCCGCCCGCGCGGACCCGGCGAGAGGCGGCGGCGGGAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl