DNA Bank Top |  KEGG KO K02159 > 

RIKEN DNA Bank Human Resource - BAX

Gene ID NCBI Gene 581 |  KEGG hsa:581
Gene Symbol BAX
Protein Name BCL2 associated X, apoptosis regulator
Synonyms BCL2L4
Featured content DNA damage
Featured content Sphingolipid signaling pathway (human)
Featured content Apoptosis - human
Featured content Huntington disease - human
Featured content Amyotrophic lateral sclerosis (ALS) - human
Featured content Influenza A relevant genes - human

Link

Ortholog resource in our bank

  BAX


External database

human BAX

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB07802 pCAcchBax-alpha(R)    
RDB05340 pAxCALNLhBAX(reverse) Shuttle vector to generate rAd expressing human BAX    
RDB05339 pAxCALNLhBAX(forward) Shuttle vector to generate rAd expressing human BAX    
RDB05315 pAxCALNLhBAX(reverse) Shuttle vector to generate rAd expressing human BLNK    
RDB05314 pAxCALNLhBAX(forward) Shuttle vector to generate rAd expressing human BLNK    
RDB02026 pAxCALNLhBax alpha Shuttle vector to generate rAd Human Bax alpha expression    
RDB02025 AxCALNLhBax-alpha Recombinant adenovirus expressing human Bax alpha regulated by CAG promoter, loxP    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY092244 IRAL030K04 pOTB7 BC014175 NM_138761 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE023451 W01A058K11 pENTR-TOPO IRAL030K04 BC014175 NM_138761  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR059307 ARe48E11 pKA1U5 NM_004324.3  
GGAGAGGCGGCGGCGGGAGCGGCGGTGATGGACGGGTCCGGGGAGCAGCCCAGAGGCGGG
HKR067225 ARe68B01 pKA1U5 NM_004324.3  
GGCGCGGACCCGGCGAGAGGCGGCGGCGGGAGCGGCGGTGATGGACGGGTCCGGGGAGCA
HKR077236 ARe93B12 pKA1U5 NM_004324.3  
ATCCTGGGGCGGGAGCGGCGGTGATGGACGGGTCCGGGGAGCAGCCCAGAGGCGGGGGGC
HKR168435 ARi21B11 pGCAP10 NM_004324.3  
GAGAGGCGGCGGCGGGAGCGGCGGTGATGGACGGGTCCGGGGAGCAGCCCAGAGGCGGGG
HKR182974 ARi57H06 pGCAP10 NM_004324.3  
GGCGCGGACCCGGCGAGAGGCGGCGGCGGGAGCGGCGGTGATGGACGGGTCCGGGGAGCA
HKR234295 ARiS085M07 pGCAP10 NM_004324.3  
CGGCCGGCCGATGGACCCGGGCGCGCTGCGGCCGCCCGCGCGGACCCGGCGAGAGGCGGC
HKR238688 ARiS096L24 pGCAP10 NM_004324.3  
GGAGAGGCGGCGGCGGGAGCGGCGGTGATGGACGGGTCCGGGGAGCAGCCCAGAGGCGGG
HKR342474 RBb56D02 pGCAP1 NM_004324.3  
GGCCGCCCGCGCGGACCCGGCGAGAGGCGGCGGCGGGAGCGGCGGTGATGGACGGCTCTG
HKR375706 RBd39E10 pGCAP10 NM_004324.3  
GGAGAGGCGGCGGCGGGAGCGGCGGTGATGGACGGGGCCCACCAGCTCTGAGCAGATCAT
HKR398508 RBd96E12 pGCAP10 NM_004324.3  
GGAGAGGCGGCGGCGGGAGCGGCGGTGATGGACGGGGCCCACCAGCTCTGAGCAGATCAT
HKR428098 RBdS070E02 pGCAP10 NM_004324.3  
GGCGGCCGCCCGCGCGGACCCGGCGAGAGGCGGCGGCGGGAGCGGCGGTGATGGACGGGG
HKR444341 RBdS110O05 pGCAP10 NM_004324.3  
GACGTGACCCGGGCGCGCTGCGGCCGCCCGCGCGGACCCGGCGAGAGGCGGCGGCGGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2024.10.02

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl