Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03161

HP ID(1) HP03161
Gene ID(2) 5728
Gene Symbol finder PTEN
Protein Name phosphatase and tensin homolog
RefSeq NM_000314.4
Length of RefSeq (bp) 5572
Chromosome 10q23.3
Reference DDBJ accession
UniGene Hs.500466

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS122P03 pGCAP10 GCCTCTCGGAAGCTGCAGCCATGATGGAAGTTTGAGAGTTGAGCCGCTGTGAGGCGAGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl