Prev. |  KEGG KO K01110 > 

RIKEN DNA Bank Human Resource - PTEN

Gene ID NCBI Gene 5728 |  KEGG hsa:5728
Gene Symbol PTEN
Protein Name phosphatase and tensin homolog
Synonyms 10q23del|BZS|CWS1|DEC|GLM2|MHAM|MMAC1|PTEN1|PTENbeta|TEP1
Featured content Sphingolipid signaling pathway (human)
Ortholog resource in our bank

  PTEN

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB02012 AxCAhPTEN1 Recombinant adenovirus expressing human PTEN1 regulated by CAG promoter
RDB02013 pAxCAhPTEN1 Shuttle vector to generate rAd expressing human PTEN1
RDB06380 pCMFlag_hsPTEN Expression vector of human PTEN.
RDB07400 pGL4-phPTEN Promoter collection, Human PTEN promoter

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085642 IRAL014B18 pOTB7 BC005821 NM_000314 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE113645 M01C084B21 pDONR221 IMS05-G11 BC005821 NM_000314  
HGE113693 M01C084D21 pDONR221 IMS05-G11 BC005821 NM_000314  
HGE113741 M01C084F21 pDONR221 IMS05-G11 BC005821 NM_000314  
HGE113789 M01C084H21 pDONR221 IMS05-G11 BC005821 NM_000314  
HGE113837 M01C084J21 pDONR221 IMS05-G11 BC005821 NM_000314  
HGE113885 M01C084L21 pDONR221 IMS05-G11 BC005821 NM_000314  
HGE113933 M01C084N21 pDONR221 IMS05-G11 BC005821 NM_000314  
HGE113981 M01C084P21 pDONR221 IMS05-G11 BC005821 NM_000314  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR249163 ARiS122P03 pGCAP10 NM_000314.4  
GCCTCTCGGAAGCTGCAGCCATGATGGAAGTTTGAGAGTTGAGCCGCTGTGAGGCGAGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl