DNA Bank Top |  KEGG KO K01110 > 

RIKEN DNA Bank Human Resource - PTEN

Gene ID NCBI Gene 5728 |  KEGG hsa:5728
Gene Symbol PTEN
Protein Name phosphatase and tensin homolog
Synonyms 10q23del|BZS|CWS1|DEC|GLM2|MHAM|MMAC1|PTEN1|PTENbeta|TEP1
Featured content Sphingolipid signaling pathway (human)

Link

Ortholog resource in our bank

  PTEN


External database

human PTEN

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB07400 pGL4-phPTEN Promoter collection, Human PTEN promoter    
RDB06380 pCMFlag_hsPTEN Expression vector of human PTEN.    
RDB02013 pAxCAhPTEN1 Shuttle vector to generate rAd expressing human PTEN1    
RDB02012 AxCAhPTEN1 Recombinant adenovirus expressing human PTEN1 regulated by CAG promoter    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085642 IRAL014B18 pOTB7 BC005821 NM_000314 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE113645 M01C084B21 pDONR221 IMS05-G11 BC005821 NM_000314  
HGE113693 M01C084D21 pDONR221 IMS05-G11 BC005821 NM_000314  
HGE113741 M01C084F21 pDONR221 IMS05-G11 BC005821 NM_000314  
HGE113789 M01C084H21 pDONR221 IMS05-G11 BC005821 NM_000314  
HGE113837 M01C084J21 pDONR221 IMS05-G11 BC005821 NM_000314  
HGE113885 M01C084L21 pDONR221 IMS05-G11 BC005821 NM_000314  
HGE113933 M01C084N21 pDONR221 IMS05-G11 BC005821 NM_000314  
HGE113981 M01C084P21 pDONR221 IMS05-G11 BC005821 NM_000314  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR249163 ARiS122P03 pGCAP10 NM_000314.4  
GCCTCTCGGAAGCTGCAGCCATGATGGAAGTTTGAGAGTTGAGCCGCTGTGAGGCGAGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2024.10.01

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl