Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03156

HP ID(1) HP03156
Gene ID(2) 30062
Gene Symbol finder RAX
Protein Name retina and anterior neural fold homeobox
RefSeq NM_013435.2
Length of RefSeq (bp) 3197
Chromosome 18q21.32
Reference DDBJ accession
UniGene Hs.278957

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb63B05 pGCAP1 AB593018 GGAGGGCCAGTTGGCTCCCCGCCTTTAGCGCCGAGAGCCCCAGCTACCCCGAGCCCGAAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl