Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03142

HP ID(1) HP03142
Gene ID(2) 5048
Gene Symbol finder PAFAH1B1
Protein Name platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit 45kDa
RefSeq NM_000430.3
Length of RefSeq (bp) 5614
Chromosome 17p13.3
Reference DDBJ accession
UniGene Hs.77318

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe05D04 pKA1U5 GAGACGGAGCTGGAGCGGCGGGGCGGCGGCGGANTCCGGCGGCCGGGAGAGCGAGTGAGC
ARe22H05 pKA1U5 GGGGGCAGCTCCTGTGACAGACGGAGCTGGAGCGGCGGGGCGGCGGCGGAGTCCGGCGGC
ARi35A11 pGCAP10 GAGACGGAGCTGGAGCGGCGGGGCGGCGGCGGAGTCCGGCGGCCGGGAGAGCGAGTGAGC
ARiS191A13 pGCAP10 GGTGACAGACGGAGCTGGAGCGGCGGGGCGGCGGCGGAGTCCGGCGGCCGGGAGAGCGAG
RBd16D11 pGCAP10 GAGCGGCGGGGCGGCGGCGGAGTCCGGCGGCCGGGAGAGCGAGTGAGCGAGCGGAGGAGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl