Prev. |  KEGG KO K16794 > 

RIKEN DNA Bank Human Resource - PAFAH1B1

Gene ID NCBI Gene 5048 |  KEGG hsa:5048
Gene Symbol PAFAH1B1
Protein Name platelet activating factor acetylhydrolase 1b regulatory subunit 1
Synonyms LIS1|LIS2|MDCR|MDS|NudF|PAFAH
Ortholog resources KEGG ortholog (KEGG orthology K16794) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042076 ARe05D04 pKA1U5 NM_000430.3  
GAGACGGAGCTGGAGCGGCGGGGCGGCGGCGGANTCCGGCGGCCGGGAGAGCGAGTGAGC
HKR048973 ARe22H05 pKA1U5 NM_000430.3  
GGGGGCAGCTCCTGTGACAGACGGAGCTGGAGCGGCGGGGCGGCGGCGGAGTCCGGCGGC
HKR174011 ARi35A11 pGCAP10 NM_000430.3  
GAGACGGAGCTGGAGCGGCGGGGCGGCGGCGGAGTCCGGCGGCCGGGAGAGCGAGTGAGC
HKR276413 ARiS191A13 pGCAP10 NM_000430.3  
GGTGACAGACGGAGCTGGAGCGGCGGGGCGGCGGCGGAGTCCGGCGGCCGGGAGAGCGAG
HKR366483 RBd16D11 pGCAP10 NM_000430.3  
GAGCGGCGGGGCGGCGGCGGAGTCCGGCGGCCGGGAGAGCGAGTGAGCGAGCGGAGGAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl