Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03130

HP ID(1) HP03130
Gene ID(2) 81622
Gene Symbol finder UNC93B1
Protein Name unc-93 homolog B1 (C. elegans)
RefSeq NM_030930.2
Length of RefSeq (bp) 2334
Chromosome 11q13
Reference DDBJ accession
UniGene Hs.502989

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARa25B11 pKA1U5 GGCGACCGCCGCGAGTCCGCAGATAGTTTCGGGCCATGGTANGCGGAGCCGCCGCTCTAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl