Prev. | 

RIKEN DNA Bank Human Resource - UNC93B1

Gene ID NCBI Gene 81622 |  KEGG hsa:81622
Gene Symbol UNC93B1
Protein Name unc-93 homolog B1, TLR signaling regulator
Synonyms IIAE1|UNC93|UNC93B|Unc-93B1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR010035 ARa25B11 pKA1U5 NM_030930.2  
GGCGACCGCCGCGAGTCCGCAGATAGTTTCGGGCCATGGTANGCGGAGCCGCCGCTCTAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl